Haplogrupu I-M253

De Wikipedia

L'haplogrupu I-M253, tamién conocíu como I1, ye un haplogrupu del cromosoma Y. Los marcadores xenéticos confirmantes como identificadores de I-M253 son los SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187. Ye'l principal ramal del haplogrupu I-M170 (I*).

L'haplogrupu algama el so picu de frecuencies en Suecia (52% de los homes en Condau de Västra Götaland) y de Finlandia Occidental (trespasa el 50% en provincia de Satakunta ). En términos de medies nacionales, I-M253 alcuéntrase'n 35-38% de los homes suecos , 32,8% de los varones daneses, camín de 31,5% de los noruegos y cerca de 28% de los fineses de sexu masculín.

L'haplogrupu I-M253 ye'l principal ramal del haplogrupu I* (I-M170), tando presente n'Europa desde los tiempos antiguos. El principal ramal de I* ye'l I-M438, tamién conocíu como I2.

Tres ser reclasificau 2008, l'haplogrupu yera conocíu como I1a, un nome que ya se-y atribuyera a un ramal primariu, l'haplogrupu I-DF29. Los otros ramales principales de I1 (M253) son I1b (S249/Z131) y I1c (Y18119/Z17925).

Procedencia[editar | editar la fonte]

D'alcuerdu con un estudiu publicau en 2010, el I-M253 formóse va ente 3,170 y 5,000 años, nel periodu Calcolíticu n'Europa. Un nuevu estudiu, en 2015, estimaba la fonte de 3,470 a 5,070 años, o ente 3,180 y 3,760 años, gastando dos téuniques diferentes. Paez habese espardío inicialmente partiendo del territoriu que guei yeDinamarca.

Un estudiu de 2014, n'Hungría, reveló restos de nueve individuos de la Cultura de la Ceramica de Bandes, un d'ente ellos llevando el SNP M253 definidor del haplogrupu I1. Piénsase qu'esta cultura foi presente va ente 6.500 y 7.500 años.

Estructura[editar | editar la fonte]

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187) o I1

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • I-M227; I1a1a
      • I-L22 (L22/S142); I1a1b
        • I-P109; I1a1b1
        • I-L205 (L205.1/L939.1/S239.1); I1a1b2
        • I-Z74; I1a1b3
        • I-L300 (L300/S241); I1a1b4
          • I-L287
            • I-L258 (L258/S335)
          • I-L813
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Distribución territorial[editar | editar la fonte]

I-M253 alcuéntrase na so mayor densidá nel Norte d'Europa y d'otros países que sofrieren intensa migración del Norte d'Europa, bien nel Periodu de Migración, bien nel periodu viquingu o bien en tiempos modernos. Atópase'n tolos sitios invadios polos antiguos pueblos xermánicos y viquingos.

Na dómina moderna, poblaciones significatives del I-M253  tamién echaren raigañu nes naciones d'inmigrantes ex-colonies europees, tales como los USA, Australia y el Canadá.

Población tamañu patrón
I (total) I1 (I-M253) I1a1a (I-M227) fonte
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Bielorrusia: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
Bielorrusia: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
República Checa 47 31.9 8.5 0.0 Underhill et al. 2007
República Checa 53 17.0 1.9 0.0 Rootsi et al. 2004
Dinamarca 122 39.3 32.8 0.0 Underhill et al. 2007
Inglaterra 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finlandia (nacional) 28.0 Lappalainen et al. 2006
Finlandia: Oeste 230 40 Lappalainen et al. 2008
Finlandia: Este 306 19 Lappalainen et al. 2008
Finlandia : Satakunta 50+ Lappalainen et al. 20089
França 58 17.2 8.6 1.7 Underhill et al. 2007
Francia 12 16.7 16.7 0.0 Cann et al. 2002

(Baxa- Normandía)

42 21.4 11.9 0.0 Rootsi et al. 2004
Alemaña 125 24 15.2 0.0 Underhill et al. 2007


171 15.8 2.3 0.0 Underhill et al. 2007
Hungría 113 25.7 13.3 0.0 Rootsi et al. 2004
Irlanda 100 11 6.0 0.0 Underhill et al. 2007
Kazán Tártaros 53 13.2 11.3 0.0 Trofimova 2015
Letonia 113 3.5 Lappalainen et al. 2008
Lituania 164 4.9 Lappalainen et al. 2008
Paises Baxos 93 20.4 14 0.0 Underhill et al. 2007
Noruega 2826 31.5 Eupedia 2017 [fai falta fonte meyor?]
Rusia (nacional) 16 25 12.5 0.0 Cann et al. 2002


130 16.9 5.4 0.0 Underhill et al. 2007
Rusia Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Rusia Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Rusia Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Rusia Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Rusia Cossacos 89 24.7 4.5 0.0 Underhill et al. 2007
Rusia Carelios 140 10 8.6 0.0 Underhill et al. 2007
Rusia  Carelios 132 15.2 Lappalainen et al. 2008


39 5.1 2.6 0.0 Underhill et al. 2007
Eslovaquia 70 14.3 4.3 0.0 Rootsi et al. 2004
Eslovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Suecia (nacional) 160 35.6 Lappalainen et al. 2008
Suecia  (nacional) 38.0 Lappalainen et al. 2009
Suecia: Västra Götaland 52 Lappalainen et al. 2009
Suiza 144 7.6 5.6 0.0 Rootsi et al. 2004
Turquía 523 5.4 1.1 0.0 Underhill et al. 2007
Ucraína Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
Ucraína Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
Ucrania  Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ucraína Tcherkássi 114 28.1 4.3 0.0 Underhill et al. 2007
Ucraína Belgorod 56 26.8 5.3 0.0 Underhill et al. 2007

Suecia[editar | editar la fonte]

Dinamarca[editar | editar la fonte]

Noruega[editar | editar la fonte]

Finlandia[editar | editar la fonte]

Gran Bretaña[editar | editar la fonte]

Mapa amuesando la distribución de cromosomes Y nuna seición tresversal d'Inglaterra y País de Gales, del trabayu "Cromosoma Y: evidencia de migración masiva d'anglo-saxones". los autores atribuen les diferencies en frecuencia del haplogrupu I a la migración anglo-saxona en masa pa Inglaterra, magar non seya ansí en casu del País de Gales.

En 2002 asoleyóse un artículu escritu por Michael E. Weale y colegues presentando evidencia xenética de les diferencies ente les poblaciones inglesa y galesa, incluindo un nivel peracentuablemente mas altu d'haplogrupu I-ADN n' Inglaterra que nel País de Gales. Viose esto entós como una evidencia convincente de la invasión anglo-saxona masiva del oriente de Gran Bretaña a partir del Norte d' Alemaña yDinamarca, pa contra el Periodu de Migración. Los autores asumen tener fundaose les poblaciones con fuertes proporciones d' haplogrupu I n'Alemanha del norte o nel sur d'Escandinavia, sobremanera de Dinamarca, y migrar los sos antepasaos pel Mar del Norte cabo les migraciones anglo-saxones y viquingues daneses. La principal reivindicación de los investigadores foi:

que diba ser necesaria d'aquella un eventu d'inmigración anglo-saxona afectando al 50-100% del fundu xenéticu de los homes de la Inglaterra Central. Observamos, mentanto, nun nos dexar diferenciar los nuesos datos un eventu cenciellamente adicionau al fundu xenéticu autóctonu de los homes de la Inglaterra Central d'otru onde los homes autóctonos fueren dixebraos ayures o u os varones nativos fueren reducíos en númberu ... Esti estudiu amuesa que la raya galesa yera mas una barrera xenética pal cromosoma Y y pal fluxu de xenes anglo-saxon que'l mesmu Mar del Norte ... Estos resultaos indiquen ser una frontera política mas importante que una xeofísica nuna estructuración xenética de la población.

Distribución los haplogrupos del cromosoma Y de Capelli et al. (2003).L' haplogrupu I anda presente'n toles poblaciones, coles frecuencies mas altes       n' oriente y baxes frecuencies      n'occidente. Paez nun haber una llende discontinua como apercibío por Weale et al. (2002)

En 2003, un artículu asoleyau por Christian Capelli y colegues apoyara, magar que modificaes, les conclusiones de Weale y colegues. Esi trabayu, que presentó especímes de Gran Bretaña e d'Irlanda en cuadriella, atopó una menor diferencia ente amueses galeses ya ingleses, con una diminución gradual na frecuencia nel haplogrupu I empobinándose escontra occidente nel sur de Gran Bretaña. Los resultaos indiquen a los autores tener influío a esgaya los invasores viquingos noruegos la parte norte de les Islles Britániques, magar tener toles amueses ingleses y escoceses de Gran Bretaña influencia alemana y/o danesa.

Miembros prominentes del I-M253[editar | editar la fonte]

Alexander Hamilton, per xenealoxía y prueba xenética de los sos descendientes (figurándose cierta la paternidá que-y correspuende pola so xenealoxía), foi mangau dientro l'haplogrupu Y-ADN I-M253.

Birger Jarl, 'Duque de Suecia"  de la Casa los Godos de Bjalbo, fundador d' Estocolmo, colos sos restos inhumaos nuna ilesia testaos en 2002, y resultando ser I-M253.

Ocupantes del Mayflower William Brewster, Edward Winslow e George Soule per pruebes de DNA

Marcadores[editar | editar la fonte]

ADN: modelu: cadena 1 difier de la cadena 2 nún únicu par de base local (un C >> T del polimorfismu).

Les que siguen son les especificaciones téuniques de les mutaciones de los SNP y STR conocíos del haplogrupu I-M253.

Nome: M253

Tipu: SNP
Fonte: M (Peter Underhill de la Universidá de Stanford)
Posición: ChrY:13532101..13532101 (+ cadena)
Posición: (pares de base): 283
Tamañu total (pares de base): 400
Extensión: 1
Iniciador molecular F (espeyu 5'→ 3'): GCAACAATGAGGGTTTTTTTG
Iniciador molecular R (complementar 5'→ 3'): CAGCTCCACCTCTATGCAGTTT
Alteración nucleotídeos alelos (mutación): C por T

Nome: M307

Tipu: SNP
Fonte: M (Peter Underhill)
Posición: ChrY:21160339..21160339 (+ cadena)
Extensión: 1
Alteración nucleotídeos alelos (mutación): G por A

Nome: P30

Tipo: SNP
Fonte: PS (Michael Hammer , de la Universidá d'Arizona y James F. Wilson, de la Universidá d'Edimburgo)
Posición: ChrY:13006761..13006761 (+ cadena)
Extensión: 1
Alteración nucleotídeos alelos (mutación): G por A
Rexón: ARSDP

Nome: P40

Tipu: SNP
Fonte: PS (Michael Hammer y James F. Wilson)
Posición: ChrY:12994402..12994402 (+ cadena)
Extensión: 1
Iniciador molecular: GGAGAAAAGGTGAGAAACC
Iniciador molecular R: GGACAAGGGGCAGATT
Alteración nucleotídeos alelos (mutación): C por T
Rexón: ARSDP

Bancos de datos haplogrupu I